Aspergillus flavus impairs antioxidative enzymes of Sternochetus mangiferae during mycosis Essay

Aspergillus flavusimpairs antioxidative enzymesofSternochetus mangiferaeduring fungal infection

Abstraction

Insects depend upon cuticular, humoral and cellular defences to defy fungal infection, nevertheless, entomopathogenic Fungi, through co-evolution, have developed mechanisms to counter the host’s defences. They deploy a combination of assaults to transgress epidermal defence and entree the alimentary hemocoel. During colonisation, entomopathogenic Fungi produce a overplus of metabolites to stamp down the host’s immune system. Although different mechanisms of pathogenicity by entomopathogenic Fungis are investigated, surveies on the damage of insects’ antioxidative enzymes remain elusive. Here, we used the interaction ofSternochetus mangiferaeand its associated entomopathogenic fungus,Aspergillus flavus, as a theoretical account to formalize our hypothesis. Uninfected insects were exposed to fungal spores for infection to happen. We observed symptoms of fungal infection within 48 H and mortality after 120 H of incubation period. Biochemical surveies on the antioxidative enzymes, viz. catalase, peroxidase and polyphenoloxidase, in septic and clean insects revealed damage of these important enzymes. It appears thatA. flavusdisables the host’s antioxidative enzyme system that plays a important function in riddance of oxidative toxins produced during fungal infection.

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

Keywords:Aspergillus flavus,Sternochetus mangiferae, entomopathogenic Fungi, saprophytic organism

1. Introduction

Insects being the most abundant and diverse beings have attracted a assortment of pathogens including viruses, bacteriums and Fungis. However, insect disease caused by Fungis and their impact on insect populations is of agricultural involvement worldwide ( 1-3 PNAS ) . The slow development of infection and inconsistent consequences of biological control compared to chemicals has deterred their usage and betterment. An apprehension of the fungous mechanism of fungal infection is important to place fungous virulency factors that could be manipulated to speed up fungal infection and host decease so as to be in par with chemicals.

Entomopathogenic Fungi ( Hajek and Ledger, 1994 ) have evolved to counter the host’s defence system ( 11 PLoS One ) by different mechanisms that are good studied ( 14, 15, 16 PLOS ONE ) . To do infection, the fungus has to avoid, overthrow or besiege important defence systems. Given the response of works defence against fungous infection by bring forthing antioxidative enzymes, it is speculated that pathogens may impair these enzymes to avoid being killed. However, surveies on the damage of antioxidative enzymes of insects during fungal infection are equivocal. Among entomopathogenic Fungis, genusAspergillusis a complex group of anamorphic species ( Rodriques et al. , 1997 ) . Although old surveies have recordedAspergillusspecies infecting a broad scope of insects ( Ohtomo et al. , 1975 ; Lillehoj et al. , 1975 ; Widstrom et al. , 1975 ; Fennel et al. , 1977 ; Beti et al. , 1995 ) , they were non considered to be entomopathogens until late ( mention ) .

The Mangifera indica rock weevil,Sternochetus mangiferae,is a lay waste toing plague of horticultural importance. The control of this plague is fraught with troubles and restrictions due to diminutive cognition about their ethology ( Verghese et al. , 2003 ) . During aggregation ofS. mangiferae( Kamala Jayanthi et Al. 2012 ) , we noticed fungous infection in a important population of insects. Using morphological and molecular techniques, the fungus was identified asAspergillus flavus. AsA. flavusis a well-studied saprophytic organism, it was ill-defined if the fungus caused the mortality of these insects. In this survey, we report the pathogenicity ofA. flavustoS. mangiferaeand counter mechanism the fungus utilizations to colonise its host,S. mangiferae.

2. Material and methods

2.1. Insects

S. mangiferaegrownups were collected from mango rocks in the month of July 2012 at Indian Institute of Horticultural Research, Hesseraghatta, India harmonizing to the method devised by Kamala Jayanthi et Al. ( 2012 ) . The gathered grownups ( n = 2500 ) were maintained in a rampant coop of dimension 30x30x30 centimeter in unfertile research lab conditions ( 27±1°C, 75±2 % RH and 14h visible radiation and 10h dark photoperiod ) . The grownups were provided with fresh Mangifera indica foliages and H2O socked in cotton tabletad labium.

2.2.Isolation and word picture ofA. flavus

During aggregation of Mangifera indica rock weevils, fungous infection was observed to be the chief cause of mortality ( ~70 % ) in the gathered population. Initially, a white mycelial growing was observed on septic weevils followed by monogenesis after 120 h. The primary civilization of fungus was isolated by puting an septic rock weevil into a extractor tubing incorporating sterilized saline ( 1 milliliter ) and vortexed at low velocities to free the fungal spores followed by consecutive dilution. The dilutant incorporating the spores were inoculated on murphy dextroglucose agar ( PDA ) plates utilizing standard civilization techniques. The civilizations were allowed to sporulate for 120 Hs and were maintained at 4°C until farther usage ( Mythili et al. , 2010 ) . For molecular word picture, the fungous isolate was cultured in 100 milliliter of unfertile murphy dextrose stock at 27°C for 96 h. The mycelial mass was separated by filtration and was freeze dried. Deoxyribonucleic acid was extracted as described by Melo et Al. ( 2006 ) and was quantified utilizing standard spectrophotometric method. PCR ( Polymerase Chain Reaction ) reactions were performed utilizing ITS 1 forward ( TCCGTAGGTGAACCTGCGG ) and ITS 4 contrary ( TCCTCCGCTTATTGATATGC ) primers and the elaborations were carried out in 25µl reaction mixture incorporating 2.5µl of 10x PCR buffer, 1µl of 25mM MgCl2,1µl of 10mM dNTPs, 0.5µl of each primer ( 0.7µM ) , 0.3µl ( 3 U ) ofTaqpolymerase ( Pure Gene, India ) and 1µl ( 50ng ) of Deoxyribonucleic acid templet. Eppendorf gradient thermal cycler was used with the following PCR puting: an initial denaturation for 5 min at 95°C, 35 thermic rhythms of denaturation for 1 min at 95°C, tempering for 1 min at 50°C followed by extension for 1 min at 72°C and a concluding 8 min extension at 72°C. Before sequencing the amplified PCR merchandise was purified utilizing PCR purification kit ( Bioserve, India ) . The sequence was submitted to GenBank through Bankit ( Accession figure: grp3953651 ) .

2.3. Fungal Infection

For bio-assaies, conidiospore were harvested into unfertile saline to a concluding concentration of 6.8 tens 107conidia/ml. The efficaciousness of the entomopathogen was determined by exposing insects to the saline incorporating the pathogen in a petridish for either 10 min, 30 min, 60 min and 120 min. Control weevils were treated with petridish incorporating sterile distilled H2O. Each intervention contained 150 weevils. Treated weevils were placed in unfertile containers and were observed for 10 yearss. Dead weevils were removed ; surface sterilized by dunking them in 1 % Sodium hydrochloride solution for 5 min and later washed with distilled H2O. The processed weevils were placed on unfertile PDA home bases for verification of infection. This experiment was conducted in triplicates.

Enzyme extraction

Tissues of both control and infected ( 48 H after infection ) weevils were dissected and homogenized in 50 mM Tris-HCl buffer, pH 7.0 incorporating 1mM PMSF. The homogenate was centrifuged at 4?C for 10 min at 10,000g and the supernatant collected was used as enzyme beginning. The petroleum enzymes were stored at -80?C until farther usage. Protein concentration of petroleum enzyme infusion was determined by the method of Lowry et Al ( 1951 ) utilizing bovid serum albumen as a criterion.

Antioxidative enzyme checks of septic and clean weevils

Catalase activity

A reaction mixture consisting 50mM PBS ( pH 7.0 ) , enzyme infusion and 10mM H peroxide was prepared and incubated at 28?C for 10 mins. Boiled samples with no catalase served as control. The lessening in optical density was measured and recorded at 240nm spectrophotometer over a period of 3 mins. One unit of catalase activity was expressed as the sum of enzyme capable of catalysing the debasement of one micromole of H peroxide reduced per minute per mg of protein, utilizing an extinction coefficient of 39.4 millimeters1centimeter1( Aebi, 1984 ) . Each check was run in triplicates.

Peroxidase activity

Peroxide activity was assayed spectrophotometrically at 470 nanometers utilizing catechol as a phenolic substrate with H peroxide ( Diaz et al. , 2001 ) . The reaction mixture contained 0.15 milliliter of 4 % ( v/v ) guaiacol, 0.15 milliliter of 1 % ( v/v ) Hydrogen2Oxygen2, 2.66 milliliter of 0.1M phosphate buffer ( pH 7.0 ) and 40 µl of the enzyme infusion. The same mixture solution without the enzyme infusion served as control. All checks were run in triplicates.

Polyphenol oxidase activity

Polyphenoloxidase activity was measured as described Jiang et Al ( 2003 ) but with minor alteration. The reaction mixture consisted of 50 millimeters sodium phosphate buffer ( pH 7.0 ) , 2 millimeter Dopastat to which 100 µl of enzyme infusion was added. The rate of addition in optical density at 472nm was recorded utilizing a spectrophotometer. One unit of PPO activity is defined as the sum of enzyme that increases the optical density of 0.01 units per min at 472nm. Chemical reaction mixture without the enzyme served as space.

Native PAGE and activity staining

Equal sum of protein from both infected and clean ( control ) weevils were subjected to native PAGE utilizing 8 % polyacrylamide gel ( Davis 1964 ) under non-denaturing and non-reducing conditions. For activity staining and visual image of gels, methods described antecedently for catalase ( Woodbury et al 1971 ) , peroxidase ( Lin et al. , 2002 ) and polyphenol oxidase ( Rescigno et al. , 1997 ) were followed.

Data Analysiss

Mortality ( % ) of weevils dipped into saline containing pathogens for changing clip intervals was angular transformed and subjected to Analysis of Variance ( ANOVA ) . Probit analysis was used to find the LT50values.

Consequences and Discussion

Insects have developed a formidable array of defences against pathogens that are omnipresent in the eco-system they inhabit. These extend from extremely specialised cuticle to other specialised defences. However, pathogens besides have co-evolved with their hosts to counter these defences. Although cognition about different counter mechanisms of Fungis to get the better of their hosts’ defences is studied, probe on the damage of antioxidative enzymes by entomopathogenic Fungi remains elusive.

The molecular designation utilizing the primers ITS 1 and 4 through PCR successfully amplified a merchandise of ~650bp from the genomic DNA isolated from the stray fungus ( Fig.1 ) . The sequence of the amplified merchandise was subjected to nucleotide BLAST. From the consequences, the amplified PCR merchandise showed 99 % similarity toA. flavus. This sequence was submitted to NCBI and was given a GenBank accession figure: grp3953651.

A. flavusis an effectual fungal pathogen infecting a broad scope of insects, but, its usage in biological control is hindered because it produces aflatoxin, a carcinogenic secondary metabolite ( Klich et al. , 2007 ) . Previous surveies on the pathogenicity ofA. flavusto a assortment of insects are already reported ( Glare et al. , 2002 ; Kostantopoulou and Mazomenos, 2005 ) . The present survey established the pathogenicity ofA. flavusto mango rock weevil. The open weevils showed symptoms of fungal infection within 48h of intervention. They became inactive, stopped feeding, defecated watery body waste and failed to aggregate with healthy weevils. There was important fluctuation ( F = 171.64 ;Phosphorus& A ; lt ; 0.0001 ; df = 140 ) in mortality of weevil that were exposed toA. flavusspores at 10 min, 30 min, 60 min and 120 min ( Table 1 ) . Probit analysis determined LT50( Deadly Time ) to be 24.9 ± 8.5 min ( slope = 4.18 ± 0.14,Phosphorus= 0.48 ) .A. flavuswas effectual in set uping infection at a low exposure clip ( Table 3 ) and killed 90 % of the exposed weevils. This confirmed thatA. flavuswas extremely infective to mango rock weevils.

Native PAGE gel activity staining for catalase, peroxidase and polyphenol oxidase revealed that clean Mangifera indica rock weevils produced 2 isoforms of catalase, a peroxidase and a polyphenol oxidase. However, activity staining for the above enzymes from infested weevils ( 48 H incubated weevils ) revealed that one of the isoform of catalase, peroxidase and polyphenol oxidase was inhibited. Catalase activity was reduced by 73 % in tissues of septic weevils compared to tissues of clean weevils. Similarly, peroxidase activity was reduced by 82 % and polyphenol oxidase activity by 91 % . These consequences indicate thatA. flavusmay be aiming these enzyme systems. In insect-fungal pathogenesis, antioxidant enzymes systems play an of import function in riddance of ROS ( Zhoa et al. , 2013 ; Rahimizadeh etal. , 2007 ; Li etal. , 2005 ) . Decreased activity of these enzyme systems decreases the defence mechanism in insects ( Lebeda et al. , 1999 ) . Dowd ( 1999 ) reported the comparative suppression of polyphenol oxidase by cyclic metabolites ofAspergillusandPenicilliumspecies inSpodoptera frugiperda. In instance of saddle sore forming aphids, activity of peroxidase and chitinase were impaired ( Inbari et al. , 2003 ) by fungal infection. Therefore, in the present survey, the decreased activity of catalase, peroxidase and polyphenol oxidase ( Fig. 3 ) suggests thatA. flavusimpairs these antioxidative enzymes, therefore, doing the weevil susceptible to fungal infection.

Previous surveies have establishedA. flavusas an effectual entomopathogen to many insects. ( Sahayaraj et al. 2012 ; Gopalakrishnan, 2005 ; Selvaraj et al. , 2002 ) . Two strains ofA. flavus( VGCN9E and VGC2P ) were found effectual against larvae of the mosquito,Aedes fluviatilis( Batra et al. 1973 ; Schlein et al. 1985 ) . But, the usage ofA. flavusin commanding insects is restricted by its ill fame of bring forthing a deathly secondary metabolite, aflatoxin. This toxin is known to be carcinogenic to animate beings and worlds likewise. However, there are surveies about isolation ofA. flavusstrains that do non bring forth aflatoxin at all ( Cotty et al. 1994b ) and were used successfully as a biocontrol agent ( Dorner, 2004 ; Antilla and Cotty, 2002 ) . Similarly, entomopathogenicA. flavusstrains that do non bring forth aflatoxins can be identified for usage in commanding insect population.

Decision

Oxidative emphasis is caused by accretion of free groups such as reactive O species ( ROS ) . Small measures of ROS are formed even under normal conditions as by-products of aerophilic respiration ( Pietta, 2000 ) . However, the production of ROS additions when an being is subjected to irradiation, chemicals, metal ions or infection ( Knopowski et al. 2002 ) . Overproduction of ROS may damage the cell membrane, DNA and may do enzymatic inaction ( Martin et al. 1996 ; Berlett and Standtman 1997 ; Fnkel and Halbroook, 2000 ) . To support amendss caused by ROS, insects produce many antioxidative enzymes. Surprisingly, meager attending has been directed towards insect in this respect. It is known that these enzymes can detoxicate ROS upto a certain degree beyond which the ROS induced harm may take to the insect’s mortality. In this survey, we show that the stray strain ofA. flavusimpairs antioxidative enzymes thereby impairing detoxification. This damage in detoxification may hold led to the successful constitution of infection byA. flavuson the Mangifera indica rock weevil,Sternochetus mangiferae.